Strain Information | |
---|---|
DGRC Number | 113067 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}wun2[NP3026] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}wun2NP3026 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 45D4 |
Map Viewer | |
Related Genes | CG13955 wun wun2 |
Original Number | 3026 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP3026 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 626 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | leg disc overlapping? dorsal head ecto, ventral ecto, as, others. |
Larval GFP | sg |
Larval X-gal | cns |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Shi J, Jin Z, Yu Y, Zhang Y, Yang F, Huang H, Cai T, Xi R. A Progressive Somatic Cell Niche Regulates Germline Cyst Differentiation in the Drosophila Ovary. Curr Biol (2021) 31(4) 840-852.e5 [PubMed ID = 33340458] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np34055_0907 |
Strand | Minus |
Insertion Point | 4475006 |
Chromosome Band | 2R |
Flanking Sequence | anntttgggngcactgnctttttttgtntacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgGTCCGCACCGTTCGACGTCGAACGAAGAAGTAAGCACCG GATTTCAGAGCAGCGTTGCGCTGCCCAAATACACATATATCCAGAAACGAAATGAATACA ACAGCTGTGCTCTCTCCCGCCTTTCTATTGCAACTCTCCAGCGAGCTCTCTCATGGATAA ATGAGCGCGTGGAAGTGAATCGTACAGCGTTgatcgaagaatacataagagagaaccgtc gccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtc atcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaat tgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccttt gttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagagg catatcagnctccactgagcatnnnnntnntgggnnnnnnnnnnnnnnnnnnnnnnannn nnnnccnncntncannntngnacnnatgnncncntnnnnananancnccccnnnnncngg nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnntntnnnnccnnnnannnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnntnnna |